Review



optimized crispr design tool  (Squarespace Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Squarespace Inc optimized crispr design tool
    Optimized Crispr Design Tool, supplied by Squarespace Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/optimized+crispr+design+tool/crispr+design+tool/pm37897354-46-25-29
    Average 90 stars, based on 1 article reviews
    optimized crispr design tool - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    CRISPR:

    Article Title: Human HELQ regulates DNA end resection at DNA double-strand breaks and stalled replication forks.
    Article Snippet: .. The following guide RNA ( gRNA ) sequences targeting the second exon of HELQ and the fourth exon of CtIP were designed using an optimized CRISPR design tool ( https://zlab.squarespace.com/ guide- design- resources ) and used to edit the target genes: sgRNA-KO HELQ GTCGTCAA CTTGA GCT A T AA; sgRNAKO CtIP TC ACC AAAAATC AAC AGCTG; and sgRNA-KI HELQ CTCA CGTGA CCTGCCGCGTA (used to knock in an N-terminal SFB tag at the HELQ gene locus). ..

    Article Title: Human HELQ regulates DNA end resection at DNA double-strand breaks and stalled replication forks
    Article Snippet: .. The following guide RNA (gRNA) sequences targeting the second exon of HELQ and the fourth exon of CtIP were designed using an optimized CRISPR design tool ( https://zlab.squarespace.com/guide-design-resources ) and used to edit the target genes: sgRNA-KO HELQ GTCGTCAACTTGAGCTATAA; sgRNA-KO CtIP TCACCAAAAATCAACAGCTG; and sgRNA-KI HELQ CTCACGTGACCTGCCGCGTA (used to knock in an N-terminal SFB tag at the HELQ gene locus). ..

    Knock-In:

    Article Title: Human HELQ regulates DNA end resection at DNA double-strand breaks and stalled replication forks.
    Article Snippet: .. The following guide RNA ( gRNA ) sequences targeting the second exon of HELQ and the fourth exon of CtIP were designed using an optimized CRISPR design tool ( https://zlab.squarespace.com/ guide- design- resources ) and used to edit the target genes: sgRNA-KO HELQ GTCGTCAA CTTGA GCT A T AA; sgRNAKO CtIP TC ACC AAAAATC AAC AGCTG; and sgRNA-KI HELQ CTCA CGTGA CCTGCCGCGTA (used to knock in an N-terminal SFB tag at the HELQ gene locus). ..

    Article Title: Human HELQ regulates DNA end resection at DNA double-strand breaks and stalled replication forks
    Article Snippet: .. The following guide RNA (gRNA) sequences targeting the second exon of HELQ and the fourth exon of CtIP were designed using an optimized CRISPR design tool ( https://zlab.squarespace.com/guide-design-resources ) and used to edit the target genes: sgRNA-KO HELQ GTCGTCAACTTGAGCTATAA; sgRNA-KO CtIP TCACCAAAAATCAACAGCTG; and sgRNA-KI HELQ CTCACGTGACCTGCCGCGTA (used to knock in an N-terminal SFB tag at the HELQ gene locus). ..



    Similar Products

    optimized crispr design tool  (Benchling Inc)
    90
    Benchling Inc optimized crispr design tool
    Optimized Crispr Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/optimized+crispr+design+tool/crispr+design+tool/pmc12136713-308-26-28
    Average 90 stars, based on 1 article reviews
    optimized crispr design tool - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    crispr design tool  (Addgene inc)
    93
    Addgene inc crispr design tool
    Crispr Design Tool, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/optimized+crispr+design+tool/lenti+sgRNA(MS2)_puro+optimized+backbone+(Plasmid+%2373797)/pm38583153-276-13-27
    Average 93 stars, based on 1 article reviews
    crispr design tool - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    optimized crispr design tool  (Squarespace Inc)
    90
    Squarespace Inc optimized crispr design tool
    Optimized Crispr Design Tool, supplied by Squarespace Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/optimized+crispr+design+tool/crispr+design+tool/pm37897354-46-25-29
    Average 90 stars, based on 1 article reviews
    optimized crispr design tool - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    optimized crispr design tool  (Synthego Inc)
    90
    Synthego Inc optimized crispr design tool
    Genetic ablation of ERAD sensitizes HepG2 cells to TNFα– and IL-12–induced cell death. A, diagram <t>illustrating</t> <t>CRISPR/Cas9-mediated</t> editing of the Sel1L gene in HepG2 cells. F, R1, and R2 represent PCR primers used for genotyping of Sel1L-edited cells. Black bars represent exons. B , top , PCR analysis of Sel1L-normal (Sel1L +/+ ) and deleted (Sel1L −/− ) cells. Bottom, Western blotting analysis of SEL1L expression in Sel1L +/+ and Sel1L −/− cells; the upper band is a nonspecific band. C, average cell death level of Sel1L +/+ and Sel1L −/− cells as indicated by the mean PI fluorescence intensity. Sel1L −/− ( 1-3 ) represent three independent HepG2 cell clones. D–F, MTT assays of Sel1L +/+ and Sel1L −/− cells after treatment with increased concentrations of TNF-α ( D ), IL-12 ( E ), and TNFα + IL-12 ( F ). G and H, fluorescence reporter assay of ER stress in TNF-α ( G ) and IL-12 ( H ) treated Sel1L +/+ and Sel1L −/− cells. I, MTT assay of Sel1L +/+ and Sel1L −/− cells after treatment with TNFα or TNFα + Nec-1. J , FITC and PE dual channel FACS assay of Sel1L +/+ and Sel1L −/− cells after treatment with PBS (Mock), TNF-α, TNF-α + Ru360, or TNF-α + NAC. All data are mean ± S.E. ( n = 3). *, p < 0.05; **, p < 0.01 by Student's t test.
    Optimized Crispr Design Tool, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/optimized+crispr+design+tool/crispr+design+tool/pmc07864069-144-13-17
    Average 90 stars, based on 1 article reviews
    optimized crispr design tool - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    algorithms optimized crispr design tool zhang lab  (Bio-Rad)
    99
    Bio-Rad algorithms optimized crispr design tool zhang lab
    Genetic ablation of ERAD sensitizes HepG2 cells to TNFα– and IL-12–induced cell death. A, diagram <t>illustrating</t> <t>CRISPR/Cas9-mediated</t> editing of the Sel1L gene in HepG2 cells. F, R1, and R2 represent PCR primers used for genotyping of Sel1L-edited cells. Black bars represent exons. B , top , PCR analysis of Sel1L-normal (Sel1L +/+ ) and deleted (Sel1L −/− ) cells. Bottom, Western blotting analysis of SEL1L expression in Sel1L +/+ and Sel1L −/− cells; the upper band is a nonspecific band. C, average cell death level of Sel1L +/+ and Sel1L −/− cells as indicated by the mean PI fluorescence intensity. Sel1L −/− ( 1-3 ) represent three independent HepG2 cell clones. D–F, MTT assays of Sel1L +/+ and Sel1L −/− cells after treatment with increased concentrations of TNF-α ( D ), IL-12 ( E ), and TNFα + IL-12 ( F ). G and H, fluorescence reporter assay of ER stress in TNF-α ( G ) and IL-12 ( H ) treated Sel1L +/+ and Sel1L −/− cells. I, MTT assay of Sel1L +/+ and Sel1L −/− cells after treatment with TNFα or TNFα + Nec-1. J , FITC and PE dual channel FACS assay of Sel1L +/+ and Sel1L −/− cells after treatment with PBS (Mock), TNF-α, TNF-α + Ru360, or TNF-α + NAC. All data are mean ± S.E. ( n = 3). *, p < 0.05; **, p < 0.01 by Student's t test.
    Algorithms Optimized Crispr Design Tool Zhang Lab, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/optimized+crispr+design+tool/Image+Lab+Software/pm32497495-263-118-129
    Average 99 stars, based on 1 article reviews
    algorithms optimized crispr design tool zhang lab - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Genetic ablation of ERAD sensitizes HepG2 cells to TNFα– and IL-12–induced cell death. A, diagram illustrating CRISPR/Cas9-mediated editing of the Sel1L gene in HepG2 cells. F, R1, and R2 represent PCR primers used for genotyping of Sel1L-edited cells. Black bars represent exons. B , top , PCR analysis of Sel1L-normal (Sel1L +/+ ) and deleted (Sel1L −/− ) cells. Bottom, Western blotting analysis of SEL1L expression in Sel1L +/+ and Sel1L −/− cells; the upper band is a nonspecific band. C, average cell death level of Sel1L +/+ and Sel1L −/− cells as indicated by the mean PI fluorescence intensity. Sel1L −/− ( 1-3 ) represent three independent HepG2 cell clones. D–F, MTT assays of Sel1L +/+ and Sel1L −/− cells after treatment with increased concentrations of TNF-α ( D ), IL-12 ( E ), and TNFα + IL-12 ( F ). G and H, fluorescence reporter assay of ER stress in TNF-α ( G ) and IL-12 ( H ) treated Sel1L +/+ and Sel1L −/− cells. I, MTT assay of Sel1L +/+ and Sel1L −/− cells after treatment with TNFα or TNFα + Nec-1. J , FITC and PE dual channel FACS assay of Sel1L +/+ and Sel1L −/− cells after treatment with PBS (Mock), TNF-α, TNF-α + Ru360, or TNF-α + NAC. All data are mean ± S.E. ( n = 3). *, p < 0.05; **, p < 0.01 by Student's t test.

    Journal: The Journal of Biological Chemistry

    Article Title: ERAD deficiency promotes mitochondrial dysfunction and transcriptional rewiring in human hepatic cells

    doi: 10.1074/jbc.RA120.013987

    Figure Lengend Snippet: Genetic ablation of ERAD sensitizes HepG2 cells to TNFα– and IL-12–induced cell death. A, diagram illustrating CRISPR/Cas9-mediated editing of the Sel1L gene in HepG2 cells. F, R1, and R2 represent PCR primers used for genotyping of Sel1L-edited cells. Black bars represent exons. B , top , PCR analysis of Sel1L-normal (Sel1L +/+ ) and deleted (Sel1L −/− ) cells. Bottom, Western blotting analysis of SEL1L expression in Sel1L +/+ and Sel1L −/− cells; the upper band is a nonspecific band. C, average cell death level of Sel1L +/+ and Sel1L −/− cells as indicated by the mean PI fluorescence intensity. Sel1L −/− ( 1-3 ) represent three independent HepG2 cell clones. D–F, MTT assays of Sel1L +/+ and Sel1L −/− cells after treatment with increased concentrations of TNF-α ( D ), IL-12 ( E ), and TNFα + IL-12 ( F ). G and H, fluorescence reporter assay of ER stress in TNF-α ( G ) and IL-12 ( H ) treated Sel1L +/+ and Sel1L −/− cells. I, MTT assay of Sel1L +/+ and Sel1L −/− cells after treatment with TNFα or TNFα + Nec-1. J , FITC and PE dual channel FACS assay of Sel1L +/+ and Sel1L −/− cells after treatment with PBS (Mock), TNF-α, TNF-α + Ru360, or TNF-α + NAC. All data are mean ± S.E. ( n = 3). *, p < 0.05; **, p < 0.01 by Student's t test.

    Article Snippet: For Cas9-mediated gene editing, sgRNAs flanking exon 6 were designed using the Optimized CRISPR Design tool ( https://www.synthego.com/products/bioinformatics/crispr-design-tool ) and cloned into the expression vector pGL3-U6-2sgRNA.

    Techniques: CRISPR, Western Blot, Expressing, Fluorescence, Clone Assay, Reporter Assay, MTT Assay